Fillable Form 1: on the growth of toxic and (Inter Research Science Publisher)

Fill Online, Printable, Fillable, Blank Form 1: on the growth of toxic and (Inter Research Science Publisher) Form

Use Fill to complete blank online INTER RESEARCH SCIENCE PUBLISHER pdf forms for free. Once completed you can sign your fillable form or send for signing. All forms are printable and downloadable.

Form 1: on the growth of toxic and (Inter Research Science Publisher)

On average this form takes 1 minutes to complete

The Form 1: on the growth of toxic and (Inter Research Science Publisher) form is 18 pages long and contains:

0 signatures
0 check-boxes
2 other fields

Country of origin: US
File type: PDF

Use our library of forms to quickly fill and sign your Inter Research Science Publisher forms online.

BROWSE INTER RESEARCH SCIENCE PUBLISHER FORMS

Related forms

Fill has a huge library of thousands of forms all set up to be filled in easily and signed.

Fill in your chosen form

Sign the form using our drawing tool

Send to someone else to fill in and sign.

find another form

AQUATIC MICROBIAL ECOLOGY

Aquat Microb Ecol

Vol. 61: 149–162, 2010

doi: 10.3354/ame01445

Published online October 20

INTRODUCTION

Harmful algal blooms (HABs) are a significant threat

to fisheries, public health, and economies around the

world. There are strong links between increased nutri-

ent loading and HABs (Anderson et al. 2008, Heisler et

al. 2008), particularly within freshwater ecosystems

(Paerl 1988, Paerl et al. 2001). Traditionally, rates of pri-

mary production in freshwater ecosystems have been

thought to be limited by phosphorus (P; Schindler 1977,

Smith 1983, Hecky & Kilham 1988), and increases in P-

loading (mainly due to anthropogenic influences) have

often been associated with blooms of cyanobacteria

within these systems (Likens 1972, Paerl 1988). This

paradigm is partly based on the assumption that dia-

zotrophic cyanobacteria such as Anabaena and Apha-

nizomenon will dominate P-enriched systems that are

depleted in nitrogenous nutrients (Paerl 1982, 1988).

Nitrogen (N) may also play an important role in the

occurrence of freshwater cyanobacteria blooms, par-

*Corresponding author. Email: christopher.gobler@stonybrook.edu

Effects of nitrogenous compounds and phosphorus

on the growth of toxic and non-toxic strains of

Microcystis during cyanobacterial blooms

Timothy W. Davis

1, 3

, Matthew J. Harke

, M. Alejandra Marcoval

, Jennifer Goleski

Celia Orano-Dawson

, Dianna L. Berry

, Christopher J. Gobler

Stony Brook University, School of Marine and Atmospheric Sciences, Stony Brook, New York 11794-5000, USA

Maryland Department of Natural Resources, Annapolis, Maryland 21401, USA

Present address: Australian Rivers Institute, Griffith University, Nathan, Queensland 4111, Australia

ABSTRACT: Since the mid-twentieth century, both nutrient delivery rates and the frequency of

harmful algal blooms (HABs) in coastal aquatic ecosystems have intensified. Recent studies have

shown that nitrogen (N) or phosphorus (P) can limit primary production in freshwater systems, and

Microcystis is able to utilize both inorganic and organic forms of N. The present study quantified the

microcystin synthetase gene (mcyD) and the ribosomal RNA gene (16S) to assess how various nutri-

ent sources affected the growth of toxic and non-toxic strains of Microcystis during natural blooms.

During the present study, dense Microcystis blooms (>10

cell equivalents l

–1

) were observed within

2 contrasting ecosystems in the eastern USA: a tidal tributary and a eutrophic lake. In both systems,

all Microcystis populations were stimulated by N more frequently than P during nutrient amendment

experiments. The abundance of toxic strains of Microcystis was enhanced by nutrient enrichment

more frequently (83% of experiments) than non-toxic strains (58% of experiments), suggesting that

toxic strains may have a greater demand for both nutrients. Furthermore, abundances of toxic strains

of Microcystis were enhanced by inorganic N more frequently (67% of experiments) than organic N

(8% of experiments), while non-toxic strains were stimulated by organic N (50% of experiments)

more frequently than inorganic N (25% of experiments). Inorganic P increased abundances of toxic

strains of Microcystis more frequently than non-toxic strains (42 and 33% of experiments, respec-

tively). Therefore, the dominance of toxic Microcystis may be influenced by both the concentration

and species of nutrients, with higher concentrations of inorganic N and/or P likely promoting blooms

dominated by toxic strains and potentially yielding higher microcystin concentrations.

KEY WORDS: Microcystis · Toxic · Non-toxic · Nitrogen · Phosphorus · Inorganic · Organic ·

mcyD

Resale or republication not permitted without written consent of the publisher

Aquat Microb Ecol 61: 149–162, 2010

ticularly for non-diazotrophic cyanobacteria such as

Microcystis. Laboratory studies have demonstrated

that higher N concentrations enhance the growth and

toxicity of non-diazotrophic cyanobacteria such as

Microcystis and Oscillatoria (Watanabe & Oishi 1985,

Codd & Poon 1988, Utkilen & Gjølme 1995, Orr & Jones

1998). Some freshwater systems that have either large

external P supplies or are shallow and have strong

benthic mobilization of P from sediments can host

levels of dissolved N that limit primary production

(Vollenweider & Kerekes 1982, Paerl 2009). Finally,

recent field studies have demonstrated that N-loading

can promote Microcystis blooms (Gobler et al. 2007,

Moisander et al. 2009a).

Many cyanobacteria (both diazotrophic and non-

diazotrophic) are able to utilize both organic and in-

organic forms of N (Paerl 1988). Studies examining

assimilation by cyanobacterial blooms have observed

uptake rates were highest for ammonium, followed by

urea, then nitrate, suggesting that reduced forms of N

may promote cyanobacterial blooms (Takamura et al.

1987, Mitamura et al. 1995, Présing et al. 2008). Fur-

thermore, a recent study conducted by Dai et al. (2009)

found that a toxic clone of Microcystis aeruginosa was

able to take up and utilize amino acids, such as ala-

nine, leucine, and arginine, to support growth and

toxin production. Overall, these previous studies sug-

gest both organic and inorganic N can be important in

promoting blooms of cyanobacteria.

Bloom populations of Microcystis are comprised of

toxic and non-toxic strains, which are distinguishable

only via quantification of the microcystin synthetase

gene (mcyA-J; Kurmayer & Kutzenberger 2003, Rinta-

Kanto et al. 2005, Davis et al. 2009). Previous labo-

ratory studies have found that non-toxic strains of

Microcystis and Anabaena require lower nutrient con-

centrations to achieve maximal growth rates compared

to toxic strains (Rapala et al. 1997, Vézie et al. 2002).

Further, laboratory research suggests toxic strains of

Microcystis are able to outgrow non-toxic strains at

high inorganic N concentrations (Vézie et al. 2002).

While the role of nutrients in the growth of total Micro-

cystis populations in culture and in the field has been

studied (Watanabe & Oishi 1985, Codd & Poon 1988,

Blomqvist et al. 1994, Fujimoto et al. 1997, Orr & Jones

1998, Baldia et al. 2007, Gobler et al. 2007, Moisander

et al. 2009a), the manner in which nutrients may pro-

mote toxic and non-toxic strains of Microcysits within

an ecosystem setting is unknown.

The aim of the present study was to investigate the

role of various forms of organic and inorganic nitroge-

nous compounds, as well as orthophosphate, in the

growth of toxic and non-toxic strains of Microcystis

during natural bloom events. The dynamics of Micro-

cystis blooms and nutrients in a lake and a tidal tribu-

tary were monitored. Concurrently, nutrient amend-

ment experiments were conducted to investigate how

organic and inorganic N as well as orthophophate

affected the dominance of toxic and non-toxic strains

of Microcystis. This combined observational and

experimental approach allowed for a robust assess-

ment of how different forms of N and P may promote

toxic Microcystis blooms. To our knowledge, this is the

first study to specifically quantify the differential

responses of toxic and non-toxic strains of Microcystis

to nutrients during bloom events.

MATERIALS AND METHODS

Sampling-site and water-quality monitoring. Dur-

ing the present study, 2 hydrodynamically different

ecosystems were studied in 2008. The Transquaking

River (TR; 38° 30’ 45’ N; 75° 58’ 7’ W) is a flowing tribu-

tary that empties into the Chesapeake Bay. It spans

37 km along Maryland’s (USA) eastern shore, and has

previously been host to annual toxic cyanobacterial

blooms (Tango & Butler 2008). The seasonal rainfall

(May to September) for this system during 2008 was,

higher during May and June (14 and 11 cm, respec-

tively) when compared to July through September

(11 cm total). Lake Agawam (LA) is a small (0.5 km

shallow (4 m maximum depth), closed eutrophic sys-

tem on Long Island, New York (USA; 40° 52’ 05’’ N;

72° 25’ 96’’ W) that often experiences dense and toxic

cyanobacterial blooms (Gobler et al. 2007). In 2008,

rainfall near LA was light in May and October (5.5 and

3.2 cm, respectively) and higher from June through

September (13 ± 3.7 cm mo

–1

). Both systems had simi-

lar levels of light transmission (mean Secchi depths =

0.6 ± 0.1 m). During 2008, LA and TR were sampled bi-

weekly to monthly before, during, and after cyanobac-

terial blooms (May to November). At each site, surface

temperature, dissolved oxygen, and pH were mea-

sured using a YSI 556 sonde. Twenty liters of surface

water was collected in acid-cleaned carboys and taken

to the laboratories where triplicate extracted chloro-

phyll a and in vivo phycocyanin (as a proxy for total

cyanobacteria) were measured with Turner Designs

fluorometers using standard techniques (Parsons et al.

1984, Watras & Baker 1988, Lee et al. 1994). For micro-

cystin analysis, whole water was filtered onto triplicate

47 mm glass fiber filters (GF/F) and stored at –20°C

until analysis. Duplicate whole water samples were

preserved with Lugol’s iodine solution (5% final con-

centration) to characterize and quantify the phyto-

plankton assemblage. For molecular analysis of

Microcystis, water was filtered onto triplicate 2 µm

polycarbonate filters and immediately placed in CTAB

(cetyl trimethylammonium bromide) lysis buffer. The

150

Davis et al.: Nutrient effects on toxic Microcystis

samples were heated at 50°C for 10 min, then flash

frozen in liquid nitrogen, and stored at –80°C until

analysis. Triplicate dissolved nutrient samples were

collected by filtering lake water through combusted

GF/F glass fiber filters and stored at –20°C until analy-

sis. All nutrient analyses were conducted using wet

chemistry methods. Nitrate was analyzed by reducing

the nitrate to nitrite using spongy cadmium as per

Jones (1984). Ammonium, phosphate, and silicate

were analyzed according to Parsons et al. (1984). Urea

was analyzed following Price & Harrison (1987). Dis-

solved free amino acids (DFAA) were measured in

duplicate by high performance liquid chromatography

(HPLC) (Lindroth & Mopper 1979, Cowie & Hedges

1992). Total dissolved nitrogen and phosphorus (TDN

and TDP, respectively) were analyzed using persulfate

digestion (Valderrama 1981). Dissolved organic N and

P (DON and DOP) were determined by subtracting

DIN (dissolved inorganic N = nitrate, nitrite, and am-

monium) from TDN and by subtracting DIP (ortho-

phosphate) from TDP, respectively. The degree to

which individual biological and environmental vari-

ables were correlated was evaluated by a Pearson’s

correlation matrix.

Impacts of inorganic and organic nitrogen on toxic

and non-toxic Microcystis. Experiments were con-

ducted to assess the impact of increased organic and

inorganic N or orthophosphate concentrations on toxic

and non-toxic Microcystis populations in TR and LA.

Sets of triplicate, 1 l bottles (n = 21) were filled with

surface water from each experimental site and were

either left unamended to serve as a control, or

amended with various forms of N: 20 µM nitrate

(NO

–

), 20 µM ammonium (NH

), 10 µM (=20 µM N)

urea, 10 µM (=20 µM N), L-glutamine (GA), P (1.25 µM

orthophosphate), or a combined treatment of NO

–

and

P. For the experiments conducted in LA, the bottles

were placed in Old Fort Pond at the Stony Brook–

Southampton marine station located ~1 km west of

Lake Agawam. For the experiments conducted in TR,

experimental bottles were placed in an incubator

(REVCO) with light and temperature levels matching

conditions in TR. Light intensity and temperatures dur-

ing experiments were measured every minute with in

situ loggers (Onset Computer Corporation) and indi-

cated that incubation temperatures and light levels

remained within the same range as those found in each

ecosystem. All bottles were gently inverted every 6

to 8 h. After 48 h, samples were filtered as described

above to quantify chlorophyll a concentrations and

densities of total, toxic, and non-toxic Microcystis via

molecular methods. Using the molecular techniques

described below, the densities of total and toxic Micro-

cystis in each experimental bottle were quantified and

the densities of non-toxic Microcystis were determined

by difference, providing triplicate densities for each

population within each treatment. For the 4 communi-

ties measured (total phytoplankton, total Microcystis,

toxic Microcystis, and non-toxic Microcystis) differ-

ences in abundances among nutrient treatments were

compared by means of 1-way ANOVAs or non-para-

metric Kruskal-Wallis tests, and differences among

individual treatments were subsequently assessed

with post hoc Tukey multiple comparison tests. For all

results the standard variance presented is ± 1 standard

error (SE).

Microscopic analysis. Densities of Microcystis and

other co-occurring cyanobacteria were quantified

using gridded Sedgewick-Rafter counting chambers.

For all samples, at least 200 cells, colonies, chains, or

trichomes were enumerated. Microcystis, Anabaena,

and Aphanizomenon were enumerated to the colony,

chain, or trichome level, respectively. For eukaryotic

plankton such as diatoms, dinoflagellates, and chloro-

phytes, cells were enumerated. This approach pro-

vided good reproducibility (<15% relative standard

deviation) among samples.

Microcystin analysis. Filters for microcystin analyses

were extracted in 50% methanol containing 1% acetic

acid using ultrasound (four 20 s bursts with a 20 s

pause between bursts). Previous work has demon-

strated that this extraction protocol provides >90%

recovery of microcystin-LR from glass fiber filters

(Boyer et al. 2004). Following extraction, the methano-

lic extract was stored at –80°C until analysis. Before

analysis, the microcystin extract was diluted to 5%

methanol and buffered to a pH of 7 using a 5% Tris-

EDTA buffer solution. Microcystin concentrations

were measured using a microcystin enzyme-linked

immunosorbent assay (Abraxis LLC) following the

methodologies of Fischer et al. (2001). This assay is

congener-independent as it is sensitive to the ADDA

moiety that is found in almost all microcystins. These

analyses yielded a detection limit of 0.10 µg l

–1

, a rela-

tive standard deviation of 10 ± 1% for replicated envi-

ronmental samples, and 99.5 ± 8.2% recovery from

environmental samples spiked with 5 µg l

–1

micro-

cystin-LR, a concentration within the range of samples

collected during the present study.

Molecular analyses. Total cellular nucleic acids

were extracted from field and experimental samples

using methods described in Coyne et al. (2001). Fil-

tered environmental or experimental samples were

submersed in CTAB buffer (Dempster et al. 1999) and

supplemented with 20 µg l

–1

pGEM-3z(f+) plasmid

(Promega Corporation), which served as an internal

control for extraction efficiency and PCR inhibition

(Coyne et al. 2005). The filters were then flash frozen

using liquid nitrogen and stored at –80°C until extrac-

tion. Nucleic acids were extracted after an initial heat-

151

Aquat Microb Ecol 61: 149–162, 2010

ing step at 65°C, followed by a double chloroform

extraction, and an isopropanol precipitation. Extracted

nucleic acids were resuspended in 20 µl of LoTE

(3 mmol l

–1

Tris-HCl [pH 8.0], 0.2 mmol l

–1

EDTA

[pH 8.0]). The quantity and quality of nucleic acids

were assessed with a NanoDrop 1000 UV spectropho-

tometer (NanoDrop Technologies).

Two Microcystis-specific genetic targets were used

during the present study, the Microcystis 16S rRNA

gene (Microcystis 16S rDNA) and mcyD gene. The

Microcystis 16S rRNA gene is specific to the Micro-

cystis genus and permitted quantification of the abun-

dance of the total Microcystis population. The mcyD

gene is found within the microcystin synethtase gene

operon, which is responsible for the production of

microcystin and is only found in toxic strains of Micro-

cystis (Tillett et al. 2000), thus allowing us to quantify

the toxic population of Microcystis (Davis et al. 2009).

The non-toxic population was calculated as the differ-

ence between the total and toxic population. Quanti-

tative PCR (qPCR) was carried out using an ABI 7300

Real Time PCR instrument using TaqMan labeled

probes (Applied Biosystems) and Microcystis-specific

mcyD and 16S rDNA primers (Table 1). Each 10 µl

reaction included 5µl of 2× TaqMan Master Mix

(Applied Biosystems), 10 µM of each primer (Inte-

grated DNA Technologies), 10 µM TaqMan probe

(Table 1), and 1 µl of a 1:25 dilution of the unknown

DNA or standard. For amplification of the pGEM and

16S targets, the cycling conditions were 95°C for

10 min, followed by 55 cycles of 95°C for 15 s and

60°C for 1 min. For the mcyD gene, the cycling condi-

tions were 95°C for 10 min, followed by 55 cycles of

95°C for 15 s, followed by 50°C for 1 min, then 60°C

for 1 min. To prepare standard samples, cultured toxic

Microcystis aeruginosa, Clone LE-3 (Rinta-Kanto et al.

2005), was enumerated by standard microscopy and

collected on polycarbonate filters that were prepared

and extracted as described above for field samples. A

standard curve of dilutions of the extracted LE-3

genomic DNA was run with each analytical run to

serve as a reference for numbers of total and toxic

Microcystis cells. Such analyses indicate the number

of 16S rDNA and mcyD genes per LE-3 cell and were

not statistically different. Since some Microcystis cells

may carry varying copies of the 16S rDNA and mcyD

genes, data were expressed as ‘cell equivalents’

rather than cell number (Rinta-Kanto et al. 2005).

The numbers of toxic and total Microcystis cells

were determined using the ΔΔCT method (Livak &

Schmittgen 2001, Coyne et al. 2005). The difference

between the number of mcyD cell equivalents (toxic

cells) and 16S rDNA cell equivalents (total cells) rep-

resented the number of non-toxic cell equivalents

(Rinta-Kanto et al. 2005).

Molecular quantification of Microcystis has been

used in multiple field studies to date (e.g. Rinta-Kanto

et al. 2005, Oberholster et al. 2006, Rinta-Kanto &

Wilhelm 2006, Hotto et al. 2008, Davis et al. 2009, Ha et

al. 2009, Moisander et al. 2009a,b, Rinta-Kanto et al.

2009a,b, Ye et al. 2009, Baxa et al. 2010). Despite the

increasingly common use of this method, there are fun-

damental differences between it and traditional cell

counts that could create deviances between cell equiv-

alents and traditional microscopic counts. Traditional

microscopic counts can underestimate total Micro-

cystis densities. Individual Microcystis cells range be-

tween 4 and 6 µm in diameter, and in wild field popu-

lations both individual cells and colonies are present.

However, it is not possible to distinguish between indi-

vidual Microcystis cells and small phytoplankton in

natural bloom samples using light microscopy. In con-

trast, our molecular method quantified all Microcystis

cells caught on a 2 µm filter. Furthermore, there can be

multiple gene copies per cyanobacterium cell, which

could also lead to differences between molecular

152

DNA target Primer Sequence (5’–3’) Source

pGEM plasmid DNA M13F CCCAGTCACGACGTTGTAAAAACG Coyne et al. (2005)

pGEMR TGTGTGGAATTGTGAGCGGA Coyne et al. (2005)

pGEM probe (Taq) FAM-CACTATAGAATACTCAAGCTTGCAT Coyne et al. (2005)

GCCTGCA-BHQ-1

Microcystis 16S rDNA 184F GCCGCRAGGTGAAAMCTAA Neilan et al. (1997)

431R AATCCAAARACCTTCCTCCC Neilan et al. (1997)

Probe (Taq) FAM-AAGAGCTTGCGTCTGATTAGCTAGT- Rinta-Kanto et al. (2005)

BHQ-1

Microcystis mcyD F2 GGTTCGCCTGGTCAAAGTAA Kaebernick et al. (2000)

R2 CCTCGCTAAAGAAGGGTTGA Kaebernick et al. (2000)

Probe (Taq) FAM-ATGCTCTAATGCAGCAACGGCAAA- Rinta-Kanto et al. (2005)

BHQ-1

Table 1. Primers (Integrated DNA Technologies) and probes (Applied Biosystems) used in the qPCR analysis. F: forward primer;

R: reverse primer; FAM: 6-Carboxyfluorescein; BHQ-1: Black Hole Quencher-1 (quenching range 480 to 580 nm)

Davis et al.: Nutrient effects on toxic Microcystis

quantification and microscopic counts. Importantly, we

have consistently obtained identical cell densities of

the toxic Microcystis clone LE-3 when quantified via

light microscopy or qPCR with the 16S or mcyD gene

markers (T. W. Davis et al. unpubl. data). Furthermore,

prior studies (Davis et al. 2009) have found that toxic

(mcyD-containing) Microcystis cells are consistently (4

ecosystems, multiple years) correlated with micro-

cystin concentrations, whereas non-mcyD–containing

cell equivalents are not correlated with toxin levels,

suggesting that this method accurately enumerates

toxic and non-toxic Microcystis populations.

RESULTS

Transquaking River cyanobacteria blooms

In 2008, TR hosted dense cyanobacterial blooms

co-dominated by Microcystis and Aphanizomenon

(Table 2). Peak algal and cyanobacterial densities

occurred on 10 June, while peak Microcystis densities,

as measured by the 16S rRNA gene (3.1 ± 0.63 ×

cell equivalents l

–1

) occurred on 24 June (Fig. 1).

Within the total Microcystis population, toxic strains

dominated from late May through early July with peak

densities of 2.8 ± 0.23 × 10

cell equivalents l

–1

, repre-

senting 62 ± 20% of the total Microcystis population

(Fig. 1). After mid-July, dominance shifted towards

non-toxic strains of Microcystis, which achieved peak

densities of 3.6 ± 0.13 × 10

cell equivalents l

–1

in late

August (Fig. 1). Microcystis colonies in TR on average

comprised 47 ± 19 cells. Microcystin concentrations

ranged from 0.36 to 12.1 µg l

–1

and peaked in unison

with toxic Microcystis densities on 24 June (Fig. 1).

Microcystin concentrations were significantly corre-

lated with toxic Microcystis densities (p < 0.01), but not

153

Sampling date Microcystis Anabaena Aphanizomenon Diatoms Chlorophytes Dinoflagellates

Transquaking River

13 May 325 (25) 0 (0) 0 (0) 1100 (25) 125 (30) 0 (0)

10 Jun 400 (27) 35000 (110) 0 (0) 130 (9) 0 (0) 210 (80)

24 Jun 4900 (100) 700 (100) 51000 (2800) 2600 (220) 1100 (100) 3000 (180)

9 Jul 7350 (250) 125 (125) 120000 (7100) 16000 (1100) 3900 (580) 125 (130)

29 Jul 4800 (80) 15 (15) 20000 (1400) 1400 (10) 990 (50) 210 (70)

26 Aug 11000 (95) 240 (30) 21000 (600) 1500 (55) 15 (15) 100 (10)

9 Sep 3300 (24) 845 (12) 44000 (1100) 2800 (12) 4800 (210) 155 (10)

30 Sep 1000 (45) 0 (0) 24000 (182) 1600 (68) 3000 (50) 95 (5)

Lake Agawam

3 Jun 952 (95) 0 (0) 0 (0) 200 (20) 540 (50) 0 (0)

5 Jun 1420 (142) 0 (0) 0 (0) 170 (20) 250 (30) 0 (0)

1 Jul 813 (81) 27 (3) 13 (1) 20 (2) 67 (7) 0 (0)

23 Jul 1300 (130) 380 (38) 820 (82) 180 (20) 160 (0) 0 (0)

18 Aug 1800 (180) 0 (0) 30 (30 0 (0) 40 (4) 0 (0)

23 Sep 5000(500) 47 (5) 80 (8) 890 (90) 20 (2) 0 (0)

15 Oct 4000 (400) 0 (0) 40 (4) 170 (20) 27 (3) 0 (0)

30 Oct 4900 (490) 67 (7) 220 (22) 290 (30) 40 (40) 0 (0)

Table 2. Mean autotrophic plankton densities (SE in parentheses) as quantified via light microscopy for the Transquaking

River and Lake Agawam in 2008. Counts are in colonies, chains, and trichomes per milliliter for Microcystis, Anabaena, and

Aphanizomenon, respectively, and in cells per milliliter for the other groups

100

200

300

13 May

10 Jun

24 Jun

9 Jul

29 Jul

26 Aug

9 Sep

30 Sep

Chlorophyll a (x10 µg l

–1

)

or phycocyanin (RFU)

Temperature (°C)

Toxic, non-toxic, or total

Microcystis (10

cell equiv. l

–1

)

Chlorophyll a Phycocyanin Temperature

Total Microcystis

Toxic Microcystis

Microcystin

Non-toxic Microcystis

Microcystin (µg l

–1

)

Fig. 1. Time series of parameters measured in the Transquak-

ing River in 2008. Upper panel: levels of total chl a, phyco-

cyanin, and temperature. Lower panel: densities of total, non-

toxic, and toxic Microcystis, as well as concentrations of

microcystin. Error bars represent ±1 SE of replicated samples

Aquat Microb Ecol 61: 149–162, 2010

non-toxic Microcystis densities, chlorophyll a, phyco-

cyanin, or the total cyanobacterial densities (p > 0.05).

Concentrations of inorganic nitrogen were highest

during May and June (>1 µM), but dropped to <1 µM

during the summer and early fall (Table 2), while

DIN:DIP ratios were chronically low (3.2 ± 1.8). Silicate

levels were high in TR (25 ± 8.3 µM), while urea and

DFAA concentrations were quite low (0.3 ± 0.1 and 0.1

± 0.01 µM, respectively). DON was the largest aqueous

N pool, with concentrations ranging from 14.1 ± 6.59 to

44.8 ± 1.85 µM (Table 3), while DOP concentrations

ranged from 0.4 to 1.4 µM (Table 3). Non-toxic strains

of Microcystis were significantly correlated with DON

concentrations from June through October (p < 0.01).

Temperatures in TR rose from 13.4°C in May to 29.2°C

in July and dropped to 21.4°C by October (Fig. 1).

Lake Agawam cyanobacteria blooms

LA hosted cyanobacterial blooms that differed from

those in TR in community composition and intensity

(Table 2, Fig. 2). The LA blooms were dominated by

Microcystis on every date sampled (Table 2). Total

Microcystis densities ranged from 1.59 ± 0.09 to 17.3 ±

0.10 × 10

cell equivalents l

–1

, with peak densities

occurring on 15 October (Fig. 2). Unlike TR, the total

Microcystis community was dominated by non-toxic

strains throughout the 2008 field season (83 ± 4% of

total Microcystis cells; Fig. 2). Non-toxic strains of

Microcystis ranged from 1.42 ± 0.06 to 15.3 ± 0.06 × 10

cell equivalents l

–1

(Fig. 2), while toxic Microcystis

strains ranged from 0.7 ± 0.3 to 2.81 ± 0.20 × 10

cell

equivalents l

–1

, with peak densities occurring on

154

Sampling date Inorganic nutrients

Nitrate Ammonium Silicate DIN DIP

Transquaking River

13 May 10.25 (0) 6.36 (0.13) 16.0 (3.28) 16.6 (0.23) 3.87 (0.38)

10 Jun 1.99 (0.68) 3.56 (0.02) 1.23 (0.04) 3.77 (0.35) 2.92 (0.39)

24 Jun 0.08 (0.02) 0.84 (0.13) 48.5 (7.21) 0.92 (0.12) 1.09 (0.06)

9 Jul 0.17 (0.10) 0.74 (0.07) 71.6 (3.02) 0.91 (0.06) 0.97 (0.08)

29 Jul 0.07 (0.02) 0.57 (0.03) 11.9 (0.27) 0.65 (0.04) 0.63 (0.05)

26 Aug 0.30 (0.16) 0.62 (0.02) 10.0 (1.07) 0.91 (0.17) 0.37 (0.04)

9 Sep 0.59 (0.03) 0.57 (0.03) 27.6 (4.99) 0.82 (0.23) 0.41 (0.05)

30 Sep 0.26 (0.08) 0.57 (0.08) 15.8 (0.03) 0.69 (0.20) 0.39 (0.01)

Lake Agawam

5 Jun 5.48 (0.13) 2.45 (0.28) 22.6 (0.01) 7.94 (0.34) 0.06 (0.00)

1 Jul 1.18 (0.08) 3.44 (0.77) 20.7 (1.23) 4.62 (0.70) 0.38 (0.05)

23 Jul 1.25 (0.03) 1.23 (0.15) 45.9 (10.7) 2.06 (0.57) 0.12 (0.01)

18 Aug 0.43 (0.25) 0.48 (0.01) 59.4 (2.79) 0.78 (0.33) 0.30 (0.08)

23 Sep 4.14 (0.12) 0.47 (0.04) 68.5 (1.30) 4.61 (0.15) 0.21 (0.10)

15 Oct 6.85 (0.14) 0.68 (0.04) 68.1 (5.80) 7.53 (0.14) 0.18 (0.02)

Sampling date Organic nutrients Ratios

Urea DFAA DON DOP DIN:DIP DON:DOP

Transquaking River

13 May 0.38 (0.02) 0.1 (0.002) 14.1 (6.59) 0.61 (0.06) 4 23

10 Jun 0.42 (0.01) 0.28 (0.005) 19.4 (1.78) 1.06 (0.05) 1 18

24 Jun 0.45 (0.01) 0.1 (0.002) 24.1 (1.44) 1.05 (0.16) 1 23

9 Jul 0.31 (0.01) 0.06 (0.002) 28.5 (2.82) 0.86 (0.27) 1 33

29 Jul 0.38 (0.09) 0.07 (0.002) 21.9 (0.99) 0.31 (0.06) 1 71

26 Aug 0.13 (0.02) 0.09 (0.006) 44.8 (1.85) 0.56 (0.10) 2 79

9 Sep 0.27 (0.05) 0.05 (0.002) 24.6 (1.71) 0.47 (0.09) 2 52

30 Sep 0.14 (0.08) 0.07 (0.002) 23.9 (6.69) 0.55 (0.25) 2 43

Lake Agawam

5 Jun 0.06 (0.06) 0.13 (0.003) 17.0 (8.27) 1.09 (0.37) 262 16

1 Jul 0.05 (0.02) 0.18 (0.01) 13.4 (2.81) 0.68 (0.13) 12 20

23 Jul 0.04 (0.00) 0.10 (0.003) 14.0 (2.66) 1.15 (0.10) 17 12

18 Aug 0.06 (0.04) 0.05 (0.002) 7.94 (0.78) 0.60 (0.06) 3 13

23 Sep 0.35 (0.02) 0.09 (0.002) 12.6 (1.59) 0.72 (0.23) 22 17

15 Oct 0.26 (0.14) 0.11 (0.003) 4.91 (1.15) 0.97 (0.29) 42 5

Table 3. Mean dissolved inorganic and organic nutrient concentrations (µM with SE in parentheses) for the Transquaking

River and Lake Agawam, 2008. DIN: dissolved inorganic nitrogen; DIP: dissolved inorganic phosphate; DON: dissolved organic

nitrogen; DOP: dissolved organic phosphorus; DFAA: dissolved free amino acids

Davis et al.: Nutrient effects on toxic Microcystis

23 September (Fig. 2). Microcystis colonies in LA on

average comprised 65 ± 9 cells. As was the case in TR,

microcystin concentrations (3.1 to 17.8 µg l

–1

) were sig-

nificantly correlated with toxic Microcystis cell equiva-

lents (p < 0.01), but not with total or non-toxic Micro-

cystis cell equivalents (p > 0.05). DIN concentrations in

LA were high in the early summer (4 to 7 µM), lower in

July and August (<2 µM), and elevated again in the fall

(4 to 7 µM; Table 3). In contrast, silicate levels were

always high (20 to 70 µM) in LA (Table 3), while DIP,

urea, and DFAA were always low (<0.4, 0.1, and

0.1 µM, respectively; Table 3). DON and DOP were the

largest dissolved N and P pools in LA, with mean

concentrations of 10 ± 2 and 1.2 ± 0.2 µM (Table 3).

Temperatures in LA rose from 23.3°C in June to 27.5°C

in August and dropped to 10.3°C by the end of October

(Fig. 2).

Growth responses of toxic and non-toxic strains of

Microcystis during nutrient amendment experiments

Transquaking River

Biomass of the total phytoplankton community in TR

was significantly increased by one form of N in every

experiment conducted and was most consistently stim-

ulated by nitrate (p < 0.05; Table 4). Similarly, the total

Microcystis population in TR was stimulated by N

through most of the field season (5 of 6 experiments;

p < 0.05; Table 4, Fig. 3). Interestingly, the total Micro-

cystis community was more frequently stimulated by

urea (50% of experiments) than by nitrate (33% of

experiments), and was never stimulated by ammonium

(p < 0.05; Table 4; Fig. 3). GA also stimulated the total

Microcystis population in a third of the experiments

conducted, doubling cell equivalents above the control

in the final 2 experiments (p < 0.05; Table 4, Fig. 3).

Increased phosphate concentrations yielded signifi-

cantly increased Microcystis cell equivalents in 2

experiments conducted in June and early July (p <

0.05; Table 4, Fig. 3).

Toxic strains of Microcystis were stimulated more

often by N enrichment (83% of experiments) than their

155

3 Jun

5 Jun

1 Jul

23 Jul

17 Aug

23 Sep

15 Oct

120

160

Total Microcystis

Toxic Microcystis

Microcystin

Non-toxic Microcystis

Chlorophyll a

Phycocyanin

Temperature

Chlorophyll a (µg l

–1

)

or Phycocyanin (RFU)

Temperature (°C)

Total and non-toxic Microcystis

(10

cell equiv. l

–1

) or

microcystin (µg l

–1

)

Toxic Microcystis

(10

cell equiv. l

–1

)

Fig. 2. Time series of parameters measured in Lake Agawam

in 2008. Further details as in Fig. 1

Sampling date Total phytoplankton Total Microcystis Non-toxic Microcystis Toxic Microcystis

Transquaking River

10 Jun NO

, U, P – NO

, U, P

24 Jun N+P – U, GA, N+P NO

, NH

9 Jul NO

, N+P NO

, P – NO

, P

29 Jul NO

, NH

, U, GA P, N+P P NO

, NH

, N+P

26 Aug NO

, NH

, U, GA, N+P U, GA U, GA –

9 Sep NO

, GA, N+P U, GA, N+P U, GA N+P

Lake Agawam

5 Jun – – – P

1 Jul NH

, P, N+P – – NH

, P, N+P

23 Jul N+P NO

, NH

, U, P NO

, NH

, U, P NO

18 Aug NO

, U, GA, N+P NO

, U, P, N+P NO

, U, P, N+P –

23 Sep N+P – – NO

, NH

15 Oct – NO

, NH

, U, GA, P, N+P NO

, NH

, U, GA, P, N+P NO

, NH

, P

Table 4. Treatments that significantly stimulated the total cyanobacterial community, total Microcystis community, non-toxic

Microcystis, and toxic Microcystis relative to control treatments (p < 0.05) during nutrient amendment experiments in the

Transquaking River and Lake Agawam in 2008. NO

: nitrate; NH

: ammonium; N + P: nitrate and orthophosphate; P: orthophos-

phate; U: urea; GA:

L-glutamine. A dash indicates no treatment significantly increased the population over the control

Aquat Microb Ecol 61: 149–162, 2010

non-toxic counterparts (66% of experiments; p < 0.05;

Table 4, Fig. 3). Toxic strains were stimulated by inor-

ganic forms of N during most experiments (83%),

increasing cell equivalents from 1 to 4 times above the

control (p < 0.05; Table 4, Fig. 3). In contrast, cell

equivalents of toxic strains were enhanced by urea in

only 1 experiment, but were never affected by GA

(Table 4, Fig. 3). P additions yielded increased toxic

Microcystis in one-third of the all TR experiments,

increasing cell equivalents, on average, 2-fold beyond

the control (p < 0.05; Table 4, Fig. 3). Finally, on 2 dates

(29 July and 9 September), the combined addition of

N and P stimulated toxic Microcystis populations (p <

0.05; Table 4, Fig. 3). In a manner nearly the opposite

of toxic strains, non-toxic strains of Microcystis were

never significantly affected by the addition of any indi-

vidual inorganic N compound (p > 0.05; Table 4,

Fig. 3). These strains were stimulated, however, by

organic N compounds (urea and GA) during half of the

experiments, displaying cell equivalents between 2

and 6 times higher than the control (p < 0.05; Table 4,

Fig. 3). Finally, non-toxic strains were significantly

enhanced above the control by P in 1 experiment and

by the dual addition of N and P in another experiment

(p < 0.05; Table 4, Fig. 3).

Lake Agawam

None of the phytoplankton populations monitored

were limited by any form of N in LA in June (Table 4,

Fig. 4). From early July to late September, the total

156

100

200

300

150

225

Control NO

Urea GA P N+P

Control NO

Urea GA P N+P Control NO

Urea GA P N+P

Control NO

Urea GA P N+PControl NO

Urea P N+P

Control NO

Urea GA P N+P

100

150

200

Total, toxic, and non-toxic Microcystis (x10

cell equiv. l

–1

)

10 June

24 June

9 July

29 July

26 August

9 September

Total Microcystis

Non-toxic Microcystis

Toxic Microcystis

Fig. 3. Total, non-toxic, and toxic Microcystis densities during nutrient amendment experiments conducted in the Transquaking

River during the summer of 2008. Error bars represent ±1 SE of triplicate experimental bottles. NO

: nitrate; P: orthophosphate;

N + P: nitrate and orthophosphate; NH

: ammonium; GA: L-glutamine. During several experiments and treatments, the non-toxic

Microcystis population was below methodological detection limits

Davis et al.: Nutrient effects on toxic Microcystis

phytoplankton community was stimulated by both in-

organic and organic forms of N (p < 0.05; Table 4).

Since the non-toxic strains of Microcystis comprised

most (84%) of the total Microcystis community in LA,

their growth responses to nutrients were generally the

same as those in the total Microcystis population. The

densities of the total and non-toxic Microcystis cells

were not affected by nutrients until late July, when

both inorganic and organic N additions yielded densi-

ties significantly higher than the control treatment (p <

0.05; Table 4, Fig. 4). In a manner similar to TR, the

total Microcystis and non-toxic populations were stim-

ulated by urea and nitrate more frequently than

ammonium, displaying cell equivalents 2 to 5 times

beyond the control (p < 0.05; Table 4, Fig. 4). The addi-

tion of P significantly enhanced total and non-toxic

Microcystis abundances in half of the experiments con-

ducted, increasing densities 2 to 9 times above the con-

trol (p < 0.05; Table 4, Fig. 4).

The response of toxic strains of Microcystis to

nutrient enrichment differed from that of other algal

populations. The abundance of toxic Microcystis cell

equivalents was significantly enhanced by nutrient

enrichment over the controls (p < 0.05) more frequently

(83% of experiments) than that of the non-toxic popu-

lation (50% of experiments; Table 4, Fig. 4). Unlike

their non-toxic counterparts, toxic Microcystis in LA

was enhanced only by inorganic forms of N, with

nitrate and ammonium yielding densities that were

between 2 to 5 times greater than that of the control

(p < 0.05; Table 4, Fig. 4). Toxic Microcystis was also

enhanced by P additions in half of the experiments, as

157

120

Total and non-toxic Microcystis (x10

cell equiv. l

–1

) or toxic Microcystis (x10

cell equiv. l

–1

)

Control NO

Urea GA P N+P Control NO

Urea GA P N+P

Control NO

Urea GA P N+P Control NO

Urea GA P N+P

Control NO

Urea GA P N+P Control NO

Urea GA P N+P

5 June

1 July

23 July

18 August

23 September

15 October

Total Microcystis

Non-toxic Microcystis

Toxic Microcystis

Fig. 4. Total, non-toxic, and toxic Microcystis densities during nutrient amendment experiments conducted in Lake Agawam

during the summer of 2008. Note that the scale for the toxic cells is 1 order of magnitude less than that of the total and non-toxic

cell scale. Error bars represent ±1 SE of triplicate experimental bottles. NO

: nitrate; NH

: ammonium; GA: L-glutamine;

P: orthophosphate; N + P: nitrate and orthophosphate

Aquat Microb Ecol 61: 149–162, 2010

P increased cell equivalents 2 to 4 times beyond those

of the controls (p < 0.05; Table 4, Fig. 4). Finally, on 1

date (1 July), the combined addition of N and P yielded

toxic Microcystis densities 2 times above that of the

control (p < 0.05; Table 4, Fig. 4).

DISCUSSION

Eutrophication is considered a primary cause of

many HABs (Paerl 1997, Anderson et al. 2008, Heisler

et al. 2008), particularly within freshwater ecosystems

(Paerl 1988, 2008, Paerl et al. 2001). Because fresh-

water ecosystems are traditionally viewed as P-limited,

management plans for such systems are commonly

aimed toward reducing P loads (Schindler et al. 2008).

The present study provides new insight into the role of

nutrients in the occurrence of toxic and non-toxic

Microcystis blooms. Specifically, the findings demon-

strate that N enrichment can promote blooms of Micro-

cystis more frequently than P and that inorganic nutri-

ents may favor toxic strains over those which cannot

produce microcystin.

Microcystis community composition differed be-

tween the 2 ecosystems studied. Toxic strains of Micro-

cystis dominated the TR community during the early

summer months (May and June) before non-toxic

strains became more abundant, whereas non-toxic

strains dominated the LA Microcystis community (83 ±

4%) on every date sampled. The dominance of toxic

strains in TR but not in LA could be related to the avail-

ability of P in each system. Vézie et al. (2002) reported

that the growth rates of toxic Microcystis exceeded

those of non-toxic strains under high P concentrations,

and concentrations of P were nearly an order of magni-

tude higher in TR (1.3 µM) compared to in LA

(0.19 µM; p < 0.05; t-test). Changes in the dominance

of toxic strains throughout the year further implicated

the importance of P for this population in TR, as P con-

centrations were significantly higher from May

through mid-July (2.2 ± 0.71 µM), when toxic strains

dominated the Microcystis population (62 ± 20%), than

in late July through October (0.45 ± 0.06 µM; p < 0.01;

t-test), when non-toxic strains were most abundant

(77 ± 7%; Table 3, Fig. 1). In addition, toxic Microcys-

tis abundances were enhanced by P more frequently

than non-toxic strains, a finding consistent with our

prior work on lakes in the northeast United States

(Davis et al. 2009). Oh et al. (2000) reported that P-

limitation can enhance the levels of microcystin per

cell in Microcystis. In contrast, we found significant

(p < 0.05) linear co-variance between densities of toxic

cells and concentrations of microcystin in each ecosys-

tem studied, suggesting cellular microcystin content

did not change substantially as P levels changed, per-

haps in part because non-toxic Microcystis cells suc-

ceeded toxic cells when P concentrations declined. The

association of toxic Microcystis with high DIP and

non-toxic strains with lower DIP may be due to several

factors. Hesse et al. (2001) reported that a microcystin-

producing Microcystis strain had a higher content

of light-harvesting pigments than non-toxic mutant

strains. Hence, the RNA and DNA required for the syn-

thesis of both light-harvesting pigments and micro-

cystin by toxic strains of Microcystis may represent a

significant P requirement.

Toxic strains of Microcystis were stimulated by N

enrichment more frequently than the non-toxic strains

during the present study (Table 5). This difference was

strongest in TR, where DIN concentrations and DIN:

DIP ratios were lowest and N enrichment enhanced

the abundance of toxic Microcystis in all but a single

experiment, but did so for the non-toxic strains in only

half of the experiments (Table 4, Fig. 4). The stronger

response of toxic Microcystis to N is consistent with

laboratory studies, which have reported that toxic

strains of Microcystis and Anabaena require higher N

concentrations to achieve maximal growth rates com-

pared to non-toxic strains (Rapala et al. 1997, Vézie et

al. 2002). Furthermore, laboratory experiments have

established clear relationships between DIN supply

and microcystin production by toxic strains of Micro-

cystis (Orr & Jones 1998, Long et al. 2001), which is

consistent with the N requirements for microcystin

synthesis, as microcystin is a N-rich compound (10 N

atoms per molecule), and studies have found that

microcystin can represent up to 2% of the cellular dry

weight of Microcystis (Nagata et al. 1997). Beyond this

N in the toxin, toxic Microcystis strains will have addi-

tional N requirements associated with the enzymes

involved in the synthesis of microcystin (Tillett et al.

2000), as well as with additional light-harvesting pig-

ments they may possess (Hesse et al. 2001). Although

the precise mechanism is unclear, toxic Microcystis

cells seem to have a higher N requirement than non-

toxic cells (Rapala et al. 1997, Vézie et al. 2002, present

study).

The species of N employed during field experiments

strongly influenced whether toxic or non-toxic strains

dominated Microcystis populations. For example, in

every experiment where toxic strains of Microcystis

were stimulated by individual N compounds (n = 8),

they were always stimulated by at least 1 form of inor-

ganic N (Table 4). On the other hand, this population

was enhanced by organic N in only 1 experiment

(Table 4). Conversely, when non-toxic strains were

stimulated by individual N forms (n = 6), this happened

more frequently via organic N compounds (n = 6) than

inorganic N compounds (n = 2; Tables 4 & 5). These

findings are consistent with the results of Vézie et al.

158

Davis et al.: Nutrient effects on toxic Microcystis

(2002), who found that increases in nitrate concentra-

tions yielded faster growth rates for toxic Microcystis

cultures compared to non-toxic cultures. While the bio-

chemical mechanism(s) responsible for these trends

are unclear, there was a clear differentiation regarding

the response of toxic and non-toxic Microcystis popu-

lations to organic and inorganic N during the present

study.

For both study sites, all Microcystis populations were

more frequently enhanced by N enrichment than by P

enrichment, indicating that, in both systems, these

populations were more N- than P-limited (Tables 4 &

5). This finding is contrary to the long held view that

freshwater ecosystems are exclusively P-limited

(Schindler 1977, Smith 1983, Hecky & Kilham 1988,

Schindler et al. 2008), but consistent with more recent

laboratory (Vézie et al. 2002) and field (Gobler et al.

2007, Moisander et al. 2009a) studies of Microcystis.

Importantly, during all of the experiments conducted

across both sites, N or P increased the abundance of 1

or more of the Microcystis populations relative to con-

trol treatments, and there were 3 occasions at each site

when increases in N and P concentrations did so, sug-

gesting these populations were occasionally co-limited

by N and P (Table 4, Figs. 3 & 4). As such, the dual

management of N and P will be required to control the

future occurrence of toxic Microcystis blooms in these,

and likely other, systems (Howarth & Paerl 2008, Lewis

& Wurtsbaugh 2008, Conley et al. 2009, Paerl 2009, Xu

et al. 2010).

The differing responses of toxic and non-toxic

strains of Microcystis during N and P enrichment, and

our observations of these populations and nutrients in

TR, provide evidence for a hypothesis that may partly

account for the seasonal dynamics of these strains in

temperate ecosystems. In TR, we observed a seasonal

transition from higher inorganic nutrients, lower

organic (DON, DOP, urea, DFAA) nutrients (Table 3),

and dominance by toxic Microcystis strains during

early summer (May to July; Fig. 1), followed by a de-

pletion of inorganic nutrients, an elevation in organic

nitrogen, and dominance by non-toxic Microcystis in

late summer (Table 3, Fig. 1). This pattern of nutrients

is common for aquatic ecosystems, as warming sum-

mer temperatures bring decreases in freshwater-

based nutrient delivery rates (Gobler & Sañudo-Wil-

helmy 2001) and increases in phytoplankton nutrient

assimilation rates (Goldman & Carpenter 1974). Thus,

while toxic Microcystis thrives on the abundant

sources of inorganic nutrients during early summer,

the depletion of these nutrients by mid-summer,

potentially due to the decreased rainfall and/or

groundwater flow, likely contributes to the demise of

this population, a pattern observed in TR. The rem-

ineralization of dead cells and higher pelagic and

benthic remineralization rates within warmer summer

waters (Boynton et al. 1995) both likely contribute

towards a water column that is enriched in DON dur-

ing late summer. The present study demonstrated that

non-toxic strains of Microcystis experience increased

growth rates after enrichment with organic com-

pounds, which could partially account for their domi-

nance during late summer in TR. This population shift

between toxic and non-toxic strains concurrent with

decreases in DIN has been found in other systems,

such as Lake Ronkonkoma, New York (Davis et al.

2009). Furthermore, Briand et al. (2009) found a simi-

lar seasonal shift in genotypes from toxic strains to

non-toxic strains in a French reservoir. This trend was

not seen in LA possibly due to the low P (mean =

0.19 µM DIP) concentrations, which may have inhib-

ited toxic strains from becoming dominant within this

system due to their high P requirement (Vézie et al.

2002); toxic strains are always a minor component of

the total Microcystis community in this system (Davis

et al. 2009, present study).

In conclusion, Microcystis populations in LA and

TR were frequently stimulated by N and, to a lesser

159

Compound Experiments (%)

Total phytoplankton Total Microcystis Non-toxic Microcystis Toxic Microcystis

Any N compound 83 (10/12) 67 (8/12) 50 (6/12) 75 (9/12)

Nitrate 50 (6/12) 42 (5/12) 25 (3/12) 58 (7/12)

Ammonium 25 (3/12) 17 (2/12) 17 (2/12) 42 (5/12)

Inorganic N 58 (7/12) 42 (5/12) 25 (3/12) 67 (8/12)

Urea 25 (3/12) 50 (6/12) 50 (6/12) 8 (1/12)

L-glutamine 33 (4/12) 25 (3/12) 33 (4/12) 0 (0/12)

Organic N 33 (4/12) 50 (6/12) 50 (6/12) 8 (1/12)

Orthophosphate 8 (1/12) 50 (6/12) 33 (4/12) 42 (5/12)

Table 5. The percentage of experiments in which N compounds significantly increased the density of the total phytoplankton

community, total Microcystis community, non-toxic Microcystis, and toxic Microcystis relative to control treatments (p < 0.05)

during nutrient amendment experiments. Percentages and number of significant treatments out of total number of experiments

(in parentheses) shown

Aquat Microb Ecol 61: 149–162, 2010

extent, P. Toxic strains of Microcystis were more fre-

quently promoted by N than non-toxic strains, but

non-toxic strains were more frequently stimulated by

organic N than toxic strains were. Therefore, domi-

nance of toxic Microcystis and, ultimately, the toxic-

ity of Microcystis blooms may be influenced by both

the concentration and species of available nutrients,

with increases in inorganic N- and/or P-loading

likely promoting blooms dominated by toxic strains

and potentially yielding higher microcystin concen-

trations.

Acknowledgements. This research was supported by a grant

from the US EPA-ECOHAB program #R83-3220. We thank

Peter Tango, Walter Butler, and Mary Price for field and labo-

ratory support in Maryland. We thank Charles Wall, Amanda

Burson, and Lindsay Koza Moore for field and laboratory

assistance. We thank Drs Greg Boyer, Nicholas Fisher, Jackie

Collier, Darcy Lonsdale, and 3 anonymous reviewers for help-

ful comments on earlier drafts of this manuscript. The Stony

Brook–Southampton Marine Science Center provided logisti-

cal support.

LITERATURE CITED

Anderson DM, Burkholder JM, Cochlan WP, Glibert PM and

others (2008) Harmful algal blooms and eutrophication:

examples of linkages from selected coastal regions of the

United States. Harmful Algae 8:39–53

Baldia SF, Evangelista AD, Aralar EV, Santiago AE (2007)

Nitrogen and phosphorus utilization in the cyanobac-

terium Microcystis aeruginosa isolated from Laguna de

Bay, Philippines. J Appl Phycol 19:607–613

Baxa DV, Kurobe T, Ger KA, Lehman PW, The SJ (2010) Esti-

mating the abundance of toxic Microcystis in the San

Francisco Estuary using quantitative real-time PCR.

Harmful Algae 9:342–349

Blomqvist P, Pettersson A, Hyenstrand P (1994) Ammonium–

nitrogen: a key regulatory factor causing dominance of

non-nitrogen-fixing cyanobacteria in aquatic systems.

Arch Hydrobiol 132:141–164

Boyer GL, Matzin MC, Shambaugh AD, Satchwell MF, Rosen

BH, Mihuc T (2004) The occurrence of cyanobacterial

toxins in Lake Champlain. In: Manley T (ed) Partnerships

and research in the new millennium. Kluwer Academic/

Plenum Publishers, New York, NY

Boynton WR, Garber JH, Summers R, Kemp WM (1995)

Inputs, transformations, and transport of nitrogen and

phosphorus in Chesapeake Bay and selected tributaries.

Estuaries 18:285–314

Briand E, Escoffier N, Straub C, Sabart M, Quibler C, Hum-

bert JF (2009) Spatiotemporal changes in the genetic

diversity of a bloom-forming Microcystis aeruginosa

(cyanobacteria) population. ISME J 3:419–429

Codd GA, Poon GK (1988) Cyanobacterial toxins. In: Rogers

LJ, Gallon JR (eds) Biochemistry of the algae and cyano-

bacteria. Clarendon Press, Oxford

Conley DJ, Paerl HW, Howarth RW, Boesch DF and others

(2009) Controlling eutrophication by reducing both nitro-

gen and phosphorus. Science 323:1014–1015

Cowie GL, Hedges JI (1992) Improved amino acid quantifica-

tion in environmental samples: charged-matched recov-

ery standards and reduced analysis time. Mar Chem 37:

223–238

Coyne KJ, Hutchins DA, Hare CE, Cary SC (2001) Assessing

temporal and spatial variability in Pfiesteria piscicida dis-

tributions using molecular probing techniques. Aquat

Microb Ecol 24:275–285

Coyne KJ, Handy SM, Demir E, Whereat EB and others (2005)

Improved quantitative real-time PCR assays for enumera-

tion of harmful algal species in field samples using an

exogenous DNA reference standard. Limnol Oceanogr

Methods 3:381–391

Dai R, Liu H, Qu J, Zhao X, Hou Y (2009) Effects of amino

acids on microcystin production of the Microcystis aerugi-

nosa. J Hazard Mater 161:730–736

Davis TW, Berry DL, Boyer GL, Gobler CJ (2009) The effects

of temperature and nutrients on the growth and dynamics

of toxic and non-toxic strains of Microcystis during cyano-

bacteria blooms. Harmful Algae 8:715–725

Dempster EL, Pryor KV, Francis D, Young JE, Rogers HJ

(1999) Rapid DNA extraction from ferns for PCR-based

analyses. Biotechniques 27:66–68

Fischer WJ, Garthwaite I, Miles CO, Ross KM and others

(2001) Congener-independent immunoassay for micro-

cystins and nodularins. Environ Sci Technol 35:4849–4856

Fujimoto N, Sudo R, Sugiura N, Inamori Y (1997) Nutrient-

limited growth of Microcystis aeruginosa and Phormidium

tenue and competition under various N:P supply ratios

and temperature. Limnol Oceanogr 42:250–256

Gobler CJ, Sañudo-Wilhelmy SA (2001) Temporal variability

of groundwater seepage and brown tide blooms in a Long

Island embayment. Mar Ecol Prog Ser 217:299–309

Gobler CJ, Davis TW, Coyne KJ, Boyer GL (2007) The interac-

tive influences of nutrient loading and zooplankton graz-

ing on the growth and toxicity of cyanobacteria blooms in

a eutrophic lake. Harmful Algae 6:119–133

Goldman JC, Carpenter EJ (1974) A kinetic approach to the

effect of temperature on algal growth. Limnol Oceanogr

19:756–766

Ha JH, Hidaka T, Tsuno H (2009) Quantification of toxic

Microcystis and evaluation of its dominance ratio in

blooms using real-time PCR. Environ Sci Technol 43:

812–818

Hecky RE, Kilham P (1988) Nutrient limitation of phytoplank-

ton in freshwater and marine environments. Limnol

Oceanogr 33:796–822

Heisler JP, Gilbert J, Burkholder J, Anderson D and others

(2008) Eutrophication and harmful algal blooms: a scien-

tific consensus. Harmful Algae 8:3–13

Hesse K, Dittmann E, Börner T (2001) Consequences of

impaired microcystin production for light-dependent

growth and pigmentation of Microcystis aeruginosa PCC

7806. FEMS Microbiol Ecol 37:39–43

Hotto AM, Satchwell MF, Berry DL, Gobler CJ, Boyer GL

(2008) Spatial and temporal diversity of microcystins and

microcystin-producing genotypes in Oneida Lake, NY.

Harmful Algae 7:671–681

Howarth R, Paerl HW (2008) Coastal marine eutrophication:

control of both nitrogen and phosphorus is necessary. Proc

Natl Acad Sci USA Lett 105:E103

Jones MN (1984) Nitrate reduction by shaking with cadmium:

alternative to cadmium colums. Water Res 18:643–646

Kaebernick M, Neilan BA, Borner T, Dittmann E (2000)

Light and the transcriptional response of the microcystin

biosynthesis gene cluster. Appl Environ Microbiol 66:

3387–3392

Kurmayer R, Kutzenberger T (2003) Application of real time

PCR for quantification of microcystin genotypes in a pop-

160

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

Davis et al.: Nutrient effects on toxic Microcystis

ulation of the toxic cyanobacterium Microcystis sp. Appl

Environ Microbiol 69:6723–6730

Lee T, Tsuzuki M, Takeuchi T, Yokoyama K, Karube I (1994)

In vivo fluorometric method for early detection of

cyanobacterial waterblooms. J Appl Phycol 6:489–495

Lewis WM Jr, Wurtsbaugh WA (2008) Control of lacustrine

phytoplankton by nutrients: erosion of the phosphorus

paradigm. Int Rev Hydrobiol 93:446–465

Likens GE (1972) Eutrophication and aquatic ecosystems. In:

Nutrients and eutrophication: the limiting-nutrient contro-

versy. Limnol Oceanogr (Spec Symp) 1:3–13

Lindroth P, Mopper K (1979) High performance liquid chro-

matographic determination of subpicomole amounts of

amino acids by precolumn fluorescence derivatization

with ophthaldialdehyde. Anal Chem 51:1667–1674

Livak KJ, Schmittgen TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the

2-ΔΔCt method. Methods 25:402–408

Long BM, Jones GJ, Orr PT (2001) Cellular microcystin con-

tent in N-limited Microcystis aeruginosa can be predicted

from growth rate. Appl Environ Microbiol 67:278–283

Mitamura O, Saijo Y, Hino K, Barbosa FAR (1995) The signif-

icance of regenerated nitrogen for phytoplankton produc-

tivity in the Rio Doce Valley Lakes, Brazil. Arch Hydrobiol

134:179–194

Moisander PH, Ochiai M, Lincoff A (2009a) Nutrient limita-

tion of Microcystis aeruginosa in northern California

Klamath River reservoirs. Harmful Algae 8:889–897

Moisander PH, Lehman PW, Ochiai M, Corum S (2009b)

Diversity of Microcystis aeruginosa in the Klamath River

and San Fancisco Bay delta, California, USA. Aquat

Microb Ecol 57:19–31

Nagata S, Tsutsumi T, Hasegawa A, Yoshida F, Ueno Y,

Watanabe MF (1997) Enzyme immunoassay for the direct

determination of microcystins in environmental water.

J AOAC Int 80:408–417

Neilan BA, Jacobs D, DelDot T, Blackall LL, Hawkins PR,

Cox PT, Goodman AE (1997) rRNA sequences and evolu-

tionary relationships among toxic and nontoxic cyanobac-

teria of the genus Microcystis. Int J Syst Bacteriol 47:

693–697

Oberholster PJ, Botha AM, Cloete TE (2006) Use of molecular

markers as indicators for winter zooplankton grazing on

toxic benthic cyanobacteria colonies in an urban Colorado

lake. Harmful Algae 5:705–716

Oh HM, Lee SJ, Jang MH, Yoon BD (2000) Microcystin

production by Microcystis aeruginosa in a phosphorus-

limited chemostat. Appl Environ Microbiol 66:176–179

Orr PT, Jones GJ (1998) Relationship between microcystin

production and cell division rates in nitrogen-limited

Microcystis aeruginosa cultures. Limnol Oceanogr 43:

1604–1614

Paerl HW (1982) Environmental factors promoting and regu-

lating N-fixing blue-green algal blooms in the Chowan

River. North Carolina Water Resour Res Inst Rep 176, Uni-

versity of North Carolina, Raleigh, NC

Paerl HW (1988) Nuisance phytoplankton blooms in coastal,

estuarine, and inland waters. Limnol Oceanogr 33:

823–847

Paerl HW (1997) Coastal eutrophication and harmful algal

blooms: importance of anthropogenic deposition and

groundwater as ‘new’ nitrogen and other nitrogen

sources. Limnol Oceanogr 42:1154–1165

Paerl HW (2008) Nutrient and other environmental controls of

harmful cyanobacterial blooms along the freshwater–

marine continuum. In: Hudnell KH (ed) Cyanobacterial

harmful algal blooms: state of the science and research

needs. Advances in experimental medicine and biology,

Vol 619. Springer Publishing, New York, NY

Paerl HW (2009) Controlling eutrophication along the fresh-

water–marine continuum: dual nutrient (N and P) reduc-

tions are essential. Estuaries Coasts 32:593–601

Paerl HW, Fulton RS, Moisander PH, Dyble J (2001) Harmful

freshwater algal blooms with an emphasis on cyanobacte-

ria. TheScientificWorldJournal 1:76–113

Parsons TR, Maita Y, Lalli CM (1984) A manual of chemical

and biological methods for seawater analysis. Pergamon

Press, Oxford

Présing M, Preston T, Takátsy A, Spröber P and others (2008)

Phytoplankton nitrogen demand and the significance of

internal and external nitrogen sources in a large shallow

lake (Lake Balaton, Hungary). Hydrobiologia 599:87–95

Price NM, Harrison PJ (1987) Comparison of methods for the

analysis of dissolved urea in seawater. Mar Biol 94:

307–317

Rapala J, Sivonen K, Lyra C, Niemela SI (1997) Variation of

microcystins, cyanobacterial hepatotoxins, in Anabaena

spp. as a function of growth stimulation. Appl Environ

Microbiol 63:2206–2212

Rinta-Kanto JM, Wilhelm SW (2006) Diversity of microcystin-

producing cyanobacteria in spatially isolated regions of

Lake Erie. Appl Environ Microbiol 72:5083–5085

Rinta-Kanto JM, Ouellette AJA, Boyer GL, Twiss MR, Bridge-

man TB, Wilhelm SW (2005) Quantification of toxic Micro-

cystis spp. during the 2003 and 2004 blooms in western

Lake Erie using quantitative real-time PCR. Environ Sci

Technol 39:4198–4205

Rinta-Kanto JM, Konopko EA, DeBruyn JM, Bourbonniere

RA, Boyer GL, Wilhelm SW (2009a) Lake Erie Microcystis:

relationship between microcystin production, dynamics of

genotypes and environmental parameters in a large lake.

Harmful Algae 8:665–673

Rinta-Kanto JM, Saxton MA, DeBruyn JM, Smith JL and

others (2009b) The diversity and distribution of toxigenic

Microcystis spp. in present day and archived pelagic and

sediment samples from Lake Erie. Harmful Algae 8:

385–394

Schindler DW (1977) Evolution of phosphorus limitation in

lakes. Science 195:260–262

Schindler DW, Hecky RE, Findlay DL, Stainton MP and others

(2008) Eutrophication of lakes cannot be controlled by

reducing nitrogen input: results of a 37-year whole-

ecosystem experiment. Proc Natl Acad Sci USA 105:

11254–11258

Smith VH (1983) Low nitrogen to phosphorus ratios favor

dominance by blue-green algae in lake phytoplankton.

Science 221:669–671

Takamura N, Iwakuma T, Yasuno M (1987) Uptake of

C and

N (ammonium, nitrate, and urea) by Microcystis in Lake

Kasumigaura. J Plankton Res 9:151–165

Tango PJ, Butler W (2008) Cyanotoxins in tidal waters of

Chesapeake Bay. Northwest Nat 15:403–416

Tillett D, Dittmann E, Erhard M, von Dohren H, Borner T,

Neilan BA (2000) Structural organization of microcystin

biosynthesis in Microcystis aeruginosa PCC7806: an inte-

grated peptide–polyketide synthetase system. Chem Biol

7:753–764

Utkilen H, Gjølme N (1995) Iron-stimulated toxin production

in Microcystis aeruginosa. Appl Environ Microbiol 61:

797–800

Valderrama JC (1981) The simultaneous analysis of total N

and total P in natural waters. Mar Chem 10:109–122

Vézie C, Rapala J, Vaitomaa J, Seitsonen J, Sivonen K (2002)

Effect of nitrogen and phosphorus on growth of toxic and

161

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

➤

➤➤

Aquat Microb Ecol 61: 149–162, 2010

nontoxic Microcystis strains and on intracellular micro-

cystin concentrations. Microb Ecol 43:443–454

Vollenweider RA, Kerekes JJ (1982) Eutrophication of waters:

monitoring, assessment, and control. OCED, Paris

Watanabe MF, Oishi S (1985) Effects of environmental factors

on toxicity of a cyanobacterium (Microcystis aeruginosa)

under culture conditions. Appl Environ Microbiol 49:

1342–1344

Watras CJ, Baker AL (1988) Detection of planktonic cyano-

bacteria by tandem in vivo fluorometry. Hydrobiologia

169:77–84

Xu H, Paerl HW, Qin B, Zhu G, Gao G (2010) Nitrogen and

phosphorus inputs control phytoplankton growth in

eutrophic Lake Taihu, China. Limnol Oceanogr 55:

420–432

Ye W, Liu X, Tan J, Li D, Yang H (2009) Diversity and dynam-

ics of microcystin-producing cyanobacteria in China’s

third largest lake, Lake Taihu. Harmful Algae 8:637–644

162

Editorial responsibility: Douglas Capone,

Los Angeles, California, USA

Submitted: March 2, 2010; Accepted: August 7, 2010

Proofs received from author(s): October 7, 2010

➤

Download
Save PDF to desktop

Email
Email completed PDF

Send for Signing
Email for others to sign

Print
Print document

NAME

Form 1: on the growth of toxic and (Inter ResearchScience Publisher)

View Audit Log
Print With Audit Log
Duplicate Document

Fillable Form 1: on the growth of toxic and (Inter Research Science Publisher)

Fill Online, Printable, Fillable, Blank Form 1: on the growth of toxic and (Inter Research Science Publisher) Form

Related forms

First 20 documents completely FREE!